View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4469-Insertion-13 (Length: 165)
Name: NF4469-Insertion-13
Description: NF4469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4469-Insertion-13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 5e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 32617071 - 32617228
Alignment:
| Q |
8 |
gaaacatgtccctatgatccaccggtcaccggaggggtcgctcacattttcaggctggcgggtagcatgactgatggatgacctcacaacactaactaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32617071 |
gaaacatgtccctatgatccaccggtcaccggaggggtcgctcacattttcaggctggcgggtagcatgactgatggatgacctcacaacactaaccaca |
32617170 |
T |
 |
| Q |
108 |
ggacctttgtacagagccattagcaatgttcctccaaatgttacaattgtgccgatta |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32617171 |
ggacctttgtacagagccattagcaatgttcctccaaatgttacaattgtgccgatta |
32617228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University