View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4469_high_5 (Length: 215)
Name: NF4469_high_5
Description: NF4469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4469_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 9091453 - 9091630
Alignment:
| Q |
20 |
tgaggatcatctacagagtatgtgtgcatgattctgatttatcgttgcattatctctcttgcaagagtatgacatactcaacttgtaagattttataaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9091453 |
tgaggatcatctacagagtatgtgtgcatgattctgatttatcgttgcattatctctcttgcaagagtatgacatactcaacttgtaagattttataaca |
9091552 |
T |
 |
| Q |
120 |
tcaattagactataacacggtacgtgtaatatgcaatgcagtaaataatttttggctttatctttttcttgataatct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9091553 |
tcaattagactataacacggtacgtgtaatatacaatgcagtaaataatttttggctttatctttttcttgataatct |
9091630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 63 - 158
Target Start/End: Original strand, 9095642 - 9095737
Alignment:
| Q |
63 |
gttgcattatctctcttgcaagagtatgacatactcaacttgtaagattttataacatcaattagactataacacggtacgtgtaatatgcaatgc |
158 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
9095642 |
gttgcattatctctcttgcaagagtatcacatactcaacttgtaagattctgtaacatcaattagactataacatggtacatgtaatatgcaatgc |
9095737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University