View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470-Insertion-4 (Length: 269)
Name: NF4470-Insertion-4
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470-Insertion-4 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 135 - 269
Target Start/End: Original strand, 23140820 - 23140954
Alignment:
| Q |
135 |
tatttccaagaggaactttaatatgagacagaggaagtatttcgcagcttccagttaaaagatattcttaccaggattatggccttgatattgtctttag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23140820 |
tatttccaagaggaactttaatatgagacagaggaagtatttcgcagcttccagttaaaagatattcttaccaggattatggccttgatattgtctttag |
23140919 |
T |
|
| Q |
235 |
ttnnnnnnnnttcgttgttgtttccgtcttcgtat |
269 |
Q |
| |
|
|| ||| ||||||||||||||||||||| |
|
|
| T |
23140920 |
ttaaaaaaaattctttgttgtttccgtcttcgtat |
23140954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 23140724 - 23140820
Alignment:
| Q |
8 |
atatcaatggaaaagaaaactagctaacatagtatagttcacttacaaactaatgagaatataattggataaaaataactaacatcttttcgatatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23140724 |
atatcaatggaaaagaaaactagctaacatagtatagttcacttacaaactaatgagaatataattggataaaaataaataacatcttttcgatatt |
23140820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 232
Target Start/End: Original strand, 23149494 - 23149527
Alignment:
| Q |
199 |
ttcttaccaggattatggccttgatattgtcttt |
232 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23149494 |
ttcttaccaagattatggccttgatattgtcttt |
23149527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University