View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470-Insertion-5 (Length: 133)
Name: NF4470-Insertion-5
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 6e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 6e-38
Query Start/End: Original strand, 13 - 112
Target Start/End: Complemental strand, 4675938 - 4675839
Alignment:
| Q |
13 |
ttcttctcttcctctattccacaaagcttgataacaaacttatactattcactgttcttccttttctcctcttttttcacccatcaacccactttctgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4675938 |
ttcttctcttcctctattccacaaagcttgataacaaacttatactattcacttttcttcttttcctcctctttttttacccgtcaacccactttctgtt |
4675839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 55 - 112
Target Start/End: Original strand, 4355016 - 4355073
Alignment:
| Q |
55 |
tactattcactgttcttccttttctcctcttttttcacccatcaacccactttctgtt |
112 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4355016 |
tactattcacttttcttcttttcctcctctttttttacccgtcaacccactttctgtt |
4355073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University