View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470_high_13 (Length: 309)
Name: NF4470_high_13
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 46289579 - 46289298
Alignment:
| Q |
16 |
catcttcttgttcttgaatcactctgtttcttctgttcccgtaaaacagtgtctccatattacgtttgttctcatctttaatgcacaaatatgctttcgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46289579 |
catcttcttgttcttgaatcactctgtttcttctgttcccgtaaaacagtgtctccatattgcgtttgttctcatctttaatgcacaaatatgctttccc |
46289480 |
T |
|
| Q |
116 |
tctgttcactttgtttcctatcccaattgaaacttctgaaggagtagagtcaagtccgtacgctctatgagagcttttcattacgagatatgctgcatat |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46289479 |
tctgttcactttgtttcctatcacaattgaaacttctgtaggagtagagtcaagtccgtacgctctatgagaacttttcattacgagatatgctgcatat |
46289380 |
T |
|
| Q |
216 |
gatgtgtttggcgttagaatcttcgttctaattctgccttctatttctaaccagttcactgttctcagttctgccacctctg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46289379 |
gatgtgtttggcgttagaatcttcgttctaattctgccttctatttctaaccagttcactgttctcagttctgccacctctg |
46289298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University