View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470_high_15 (Length: 251)
Name: NF4470_high_15
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 80 - 241
Target Start/End: Complemental strand, 47201548 - 47201387
Alignment:
| Q |
80 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201548 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
47201449 |
T |
 |
| Q |
180 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccacccctatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47201448 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccacccttatg |
47201387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 47201627 - 47201579
Alignment:
| Q |
1 |
aaaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201627 |
aaaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt |
47201579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University