View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470_high_19 (Length: 230)
Name: NF4470_high_19
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 122 - 220
Target Start/End: Complemental strand, 54229082 - 54228984
Alignment:
| Q |
122 |
gcaggggagctcctagtcaatctctctctggaactttatcttcatcaattgctaatttaacaaatcttaaacaagtgttagtcacatcttcctctcatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229082 |
gcaggggagctcctagtcaatctctctctggaactttatcttcatcaattgctaatttaacaaatcttaaacaagtgttagtcacatcttcctctcatt |
54228984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 41
Target Start/End: Complemental strand, 54229198 - 54229160
Alignment:
| Q |
3 |
acttgctcttctgattcctttgttattggcttgtaacta |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229198 |
acttgctcttctgattcctttgttattggcttgtaacta |
54229160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University