View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470_low_11 (Length: 346)
Name: NF4470_low_11
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 90 - 323
Target Start/End: Original strand, 48857418 - 48857653
Alignment:
| Q |
90 |
tagttttaaaatgcagtttgatttgattatttcatattcatctcatttgaaatttcagctaaaggtgcttatagagggtgcattttcagataaaggggta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48857418 |
tagttttaaaatgcagtttgatttgattaattcatattcatctcatttgaaatttcagctaaaggtgcttatagagggtgcattttcagataaaggtgta |
48857517 |
T |
 |
| Q |
190 |
cacactttaactagcgcacttattgcgtaaatataaaaaagctaacgtacttattttgcacatgttttat--agagtgaaattttcagatcatttaagca |
287 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48857518 |
cacactttaactaacgcacttattgcgtaaatataaaaaagctaacgtacttattttgcacatgttttatagagagtgaaattttcagatcatttaagca |
48857617 |
T |
 |
| Q |
288 |
tactttagctgatctgctgatgtattagtatttatt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857618 |
tactttagctgatctgctgatgtattagtatttatt |
48857653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 48857323 - 48857377
Alignment:
| Q |
28 |
tataactaacgagcacataaacttgccttcttaatcttagtgaatttgtgagtgt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48857323 |
tataactaacgagcacataaacttgccttcttaatgttagtgaatttgtgagtgt |
48857377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University