View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4470_low_20 (Length: 230)

Name: NF4470_low_20
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4470_low_20
NF4470_low_20
[»] chr4 (2 HSPs)
chr4 (122-220)||(54228984-54229082)
chr4 (3-41)||(54229160-54229198)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 122 - 220
Target Start/End: Complemental strand, 54229082 - 54228984
Alignment:
122 gcaggggagctcctagtcaatctctctctggaactttatcttcatcaattgctaatttaacaaatcttaaacaagtgttagtcacatcttcctctcatt 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54229082 gcaggggagctcctagtcaatctctctctggaactttatcttcatcaattgctaatttaacaaatcttaaacaagtgttagtcacatcttcctctcatt 54228984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 41
Target Start/End: Complemental strand, 54229198 - 54229160
Alignment:
3 acttgctcttctgattcctttgttattggcttgtaacta 41  Q
    |||||||||||||||||||||||||||||||||||||||    
54229198 acttgctcttctgattcctttgttattggcttgtaacta 54229160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University