View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470_low_21 (Length: 229)
Name: NF4470_low_21
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 41692553 - 41692371
Alignment:
| Q |
1 |
atatttctattttagtcctagcaattctatcataatcaaattgtcttaaggtggcatat----ttttggtgtttggaagatgttatttggacaaaaa-ca |
95 |
Q |
| |
|
|||||||||||| || ||||||| ||| |||||||||||||||||| | | ||||||| ||||| |||||||||||||||||||||||||||| || |
|
|
| T |
41692553 |
atatttctatttgagccctagcacttcaatcataatcaaattgtctggaaggggcatatatatttttgttgtttggaagatgttatttggacaaaaaaca |
41692454 |
T |
|
| Q |
96 |
agttgacatgtatgtcagatgtctctttttctttacgtgcatgttggacatcattttttaaatattttataagatattgaatc |
178 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
41692453 |
agttgacatgtatgtcagacgtcactttttctttacgtgcatgttggacataattttttaaatattttataagagattgaatc |
41692371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University