View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4470_low_9 (Length: 377)
Name: NF4470_low_9
Description: NF4470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4470_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 239 - 361
Target Start/End: Original strand, 4499382 - 4499505
Alignment:
| Q |
239 |
gcaattatgttgcaagttatggtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatga-ttttt |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4499382 |
gcaattatgttgcaagttattgtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgatttttt |
4499481 |
T |
 |
| Q |
338 |
tatacaacttgctaacatggaaat |
361 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4499482 |
tatacaacttgctaacatggaaat |
4499505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 4499233 - 4499275
Alignment:
| Q |
8 |
agagaagaaataacataccaacaaagagaagggaaataaaaga |
50 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4499233 |
agagaagaaataacataccaacaaagaaaagggaaataaaaga |
4499275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 266 - 348
Target Start/End: Complemental strand, 13233719 - 13233637
Alignment:
| Q |
266 |
aaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgattttttatacaacttg |
348 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |||||||||| || |||| |||||||||||||||| ||||||| |
|
|
| T |
13233719 |
aaaaaatggggtgatgttcataattggttcagtcaaaacgaaaaccaaataaacgggacggtaatgattttttatgcaacttg |
13233637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University