View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4471-Insertion-5 (Length: 162)
Name: NF4471-Insertion-5
Description: NF4471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4471-Insertion-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 8 - 162
Target Start/End: Complemental strand, 3513728 - 3513576
Alignment:
| Q |
8 |
caaaagaccaagaacggtcatatcatcataaacaaaaagtctaatacaaaaccttttcataagttnnnnnnnnnnnnnctaagtaggaattacttttgcc |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
3513728 |
caaaagaccaagaacggtcctatcatcataaacaaa--gtctaatacaaaaccttttcataagttaaaaaaataaaaactaagcaggaattacttttgcc |
3513631 |
T |
 |
| Q |
108 |
cgaagtactttaacgatttagctaattatacccgctatctgagacaaaaaaggac |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3513630 |
cgaagtactttaacgatttagctaattatacccgctatctgagacaaaaaaggac |
3513576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University