View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4471-Insertion-6 (Length: 94)
Name: NF4471-Insertion-6
Description: NF4471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4471-Insertion-6 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 8e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 8e-21
Query Start/End: Original strand, 33 - 94
Target Start/End: Complemental strand, 31325485 - 31325423
Alignment:
| Q |
33 |
ttctcttatgaaagtctagactatttt-catgttttgattctattgtctaattttgtatgtcc |
94 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31325485 |
ttctcttatgaaagcctagactatttttcatgttttgattctattgtctaattttgtatgtcc |
31325423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 31325538 - 31325500
Alignment:
| Q |
8 |
gtgacaatctatctaatatgcttgattctcttatgaaag |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31325538 |
gtgacaatctatctaatatgcttgattctcttatgaaag |
31325500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 32415530 - 32415577
Alignment:
| Q |
47 |
tctagactattttcatgttttgattctattgtctaattttgtatgtcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||| || ||||||| |
|
|
| T |
32415530 |
tctagactattttcatgttttgattcgtttgtccaatcttatatgtcc |
32415577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University