View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4471_low_7 (Length: 237)

Name: NF4471_low_7
Description: NF4471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4471_low_7
NF4471_low_7
[»] chr5 (1 HSPs)
chr5 (1-221)||(3513724-3513946)


Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3513946 - 3513724
Alignment:
1 aaattaaagacttataaag--tttaaggatggatcaaaaactcaatttttgcttcgtatcaacgattgatttcttacaaatttaggacatttaagtacaa 98  Q
    |||||||||||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3513946 aaattaaagacttataaagagtttaaggatggatcaaaagctcaatttttgcttcgtatcaacgattgatttcttacaaatttaggacatttaagtacaa 3513847  T
99 actaaaaaatggaaagcaacaatatgttaccaacatgtgcacactcaagagaaagcaagaacccatattattttcaagcaataataacatatactacgaa 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
3513846 actaaaaaatggaaagcaacaatatgttaccaacatgtgcacactcaagagaatgcaagaacccatattattttcaagcaataataacatatactacgaa 3513747  T
199 cgtggtgaagatgatccccaaaa 221  Q
    |||||||||||||||||||||||    
3513746 cgtggtgaagatgatccccaaaa 3513724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University