View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4472-Insertion-8 (Length: 180)
Name: NF4472-Insertion-8
Description: NF4472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4472-Insertion-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 13452564 - 13452736
Alignment:
| Q |
8 |
cgaagactaagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatcta |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13452564 |
cgaagactgagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatcta |
13452663 |
T |
|
| Q |
108 |
tgaaccggataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactttgaaacttgatgg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13452664 |
tgaaccggataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactttgaaacttgatgg |
13452736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 8822728 - 8822807
Alignment:
| Q |
47 |
accggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatctatgaaccggataaccggttc |
126 |
Q |
| |
|
|||||||| ||||| | ||| ||| |||||| |||| ||||| ||||||||||| || ||||||||| |||||||||| |
|
|
| T |
8822728 |
accggttccattccggtttcagttacgaaaatttaccgccttgctgatttggatttgtcgatgaaccggttaaccggttc |
8822807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University