View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4472-Insertion-8 (Length: 180)

Name: NF4472-Insertion-8
Description: NF4472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4472-Insertion-8
NF4472-Insertion-8
[»] chr8 (1 HSPs)
chr8 (8-180)||(13452564-13452736)
[»] chr3 (1 HSPs)
chr3 (47-126)||(8822728-8822807)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 13452564 - 13452736
Alignment:
8 cgaagactaagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatcta 107  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13452564 cgaagactgagccgcgcgttatttagccgaaaccaactcaccggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatcta 13452663  T
108 tgaaccggataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactttgaaacttgatgg 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13452664 tgaaccggataaccggttcgattccggctcggatagggaaaatgcgggttttgtctactttgaaacttgatgg 13452736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 8822728 - 8822807
Alignment:
47 accggttcaattcccgattcggttttgaaaatgaaccggcttgcggatttggatttatctatgaaccggataaccggttc 126  Q
    |||||||| ||||| | ||| |||  ||||||  |||| ||||| ||||||||||| || ||||||||| ||||||||||    
8822728 accggttccattccggtttcagttacgaaaatttaccgccttgctgatttggatttgtcgatgaaccggttaaccggttc 8822807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University