View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4472_low_1 (Length: 370)
Name: NF4472_low_1
Description: NF4472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4472_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 20 - 361
Target Start/End: Complemental strand, 2745741 - 2745400
Alignment:
| Q |
20 |
aatgaactcgtcccttcgcaacggctacaannnnnnncttcttttatcgcatactttagccggaaaatctctactaatcctgctgaaaccattgctatga |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745741 |
aatgaactcgtcccttcgcaatggctacaatttttttcttcttttatcgcatactttagccggaaaatctctactaatcctgctgaaaccattgctatga |
2745642 |
T |
|
| Q |
120 |
ttgctaatactagacctattcccatcctttgaagctcggtgatacctttggatttctttgtaaatctagcaacaagagggtcgagaattctccgatagat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745641 |
ttgctaatactagacctattcccatcctttgaagctcggtgatacctttggatttctttgtaaatctagcaacaagagggtcgagaattctccgatagat |
2745542 |
T |
|
| Q |
220 |
gaagatgaaagaaactacactgagaatgtcaaagcttgacatacttgcaggagggatgtgaaaagtggaaattttagtctccattgcagcaccttgttcc |
319 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745541 |
gaagatgaaggaaactacactgagaatgtcaaagcttgacatacttgcaggagggatgtgaaaagtggaaattttagtctccattgcagcaccttgttcc |
2745442 |
T |
|
| Q |
320 |
acaaagagtgatgccatttgactgaagacaacagagaataat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745441 |
acaaagagtgatgccatttgactgaagacaacagagaataat |
2745400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University