View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4472_low_5 (Length: 238)
Name: NF4472_low_5
Description: NF4472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4472_low_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 76 - 238
Target Start/End: Complemental strand, 50899888 - 50899725
Alignment:
| Q |
76 |
cctgcattgtttctcttacgacaatatttctgtcgaaatcaattactgtaaatcactccacaaaagcctgcatgctaagctcagaggagtgggtattgac |
175 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899888 |
cctgcattgtttctcttacgacaatatttatgtcgaaatcaattactgtaaatcactccacaaaagcctgcatgctaagctcagaggagtgggtattgac |
50899789 |
T |
 |
| Q |
176 |
gtaattagtgacccatattaatcaaagaaattacgctcgaaacta-acaaatatctaactttgt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50899788 |
gtaattagtgacccatattaatcaaagaaattacgctcgaaactatacaaatatctaactttgt |
50899725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University