View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4472_low_7 (Length: 218)
Name: NF4472_low_7
Description: NF4472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4472_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 35 - 199
Target Start/End: Original strand, 28724884 - 28725048
Alignment:
| Q |
35 |
tcattacaaaaaattagtaggtaattttattgacgatcaagaagtgaagatgactttgtctcactggaaagaactgagaatacccctgaaaataaagcat |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28724884 |
tcattacaaaaaattagtaggtaattttattgacgatcaagaagtgaagatgactttgtctcactggaaagaactgagaatacccctgaaaataaagtat |
28724983 |
T |
|
| Q |
135 |
gagcgacaaattgctcgactccaacttgagcaaattcaaaacaccgctggctttaacgacgacat |
199 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28724984 |
gagagacaaattgctcgactccaacttgagcaaattcaaaacaccgctggctttaacgacgacat |
28725048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 28727472 - 28727533
Alignment:
| Q |
132 |
catgagcgacaaattgctcgactccaacttgagcaaattcaaaacaccgctggctttaacga |
193 |
Q |
| |
|
|||||| ||||||| ||| |||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
28727472 |
catgagagacaaatggcttgactccaactcgagcaaataaaaaacaccgctggatttaacga |
28727533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 36086991 - 36086955
Alignment:
| Q |
142 |
aaattgctcgactccaacttgagcaaattcaaaacac |
178 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
36086991 |
aaatcgctcgactcaaacttgagcaaattcaaaacac |
36086955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University