View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4473_low_7 (Length: 205)
Name: NF4473_low_7
Description: NF4473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4473_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 36661475 - 36661283
Alignment:
| Q |
1 |
gaataaaccttgttggtggtggtgattcaatctttatgtggtgttaaacatgaaggttctcccataaagcccaacatcacaaaccaattcgtaaccgaca |
100 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36661475 |
gaataaaccttgtgggtggtagtgattcaatctttatgtggtgttaaacatgaaggttctcccataaagcccaacatcacaaaccaattcgtaaccgacg |
36661376 |
T |
 |
| Q |
101 |
tcggtaatactatgctaggaatttcggaaagaaatttcgacatctcccattatgccacacgtttcagccgcgtgttagaactttcattttgat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36661375 |
tcggtaatactatgctaggaatttcggaaagaaatttcgacatctcccactgtcccacacgtttcagccgcgtgttagaactttcattttgat |
36661283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University