View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4474-Insertion-11 (Length: 119)
Name: NF4474-Insertion-11
Description: NF4474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4474-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 12 - 119
Target Start/End: Complemental strand, 32714837 - 32714732
Alignment:
| Q |
12 |
ggtgaataaaggggattggctagctaggaaagcaggaagaaatggtcctatgatttatcgcatctgatgtttgcagatgatttgttacttttcgaacagg |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32714837 |
ggtgaataaaggggattgactagctaggaaagcaggaagaaatggtcctatga--tatcgcatctgatgtttgcagatgatttgttacttttcgaacagg |
32714740 |
T |
 |
| Q |
112 |
ctaaaggg |
119 |
Q |
| |
|
||| |||| |
|
|
| T |
32714739 |
ctacaggg |
32714732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University