View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4474-Insertion-8 (Length: 289)
Name: NF4474-Insertion-8
Description: NF4474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4474-Insertion-8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 7 - 195
Target Start/End: Original strand, 52273963 - 52274153
Alignment:
| Q |
7 |
agaaggtaaggcttcgaaatcttcgtcgctatccatgtttgattctgagatctgaacgacactttttggttttggaaacaaaggctttaaccttgtcgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52273963 |
agaaggtaaggcttcgaaatcttcgtcgctatccatgtttgattctgagatctgaacgacactttttggttttggaaacaaaggctttaaccttatcgaa |
52274062 |
T |
|
| Q |
107 |
ttaaaacggatcgtgaaatggttctagtccaaacctaacctaaataaatggcggtaaatttgtttgaaaattctat--aaacgcgccatac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52274063 |
ttaaaacggatcgtgaaatggttctagtctaaacctaacctaaataaatggcggtaaatttgtttgaaaattctataaaaacgcgccatac |
52274153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 52274203 - 52274247
Alignment:
| Q |
245 |
aatttaatttaattttgcacatgttaatttagctaggtatacggg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52274203 |
aatttaatttaattttgcacatgttaatttagctaggtatacggg |
52274247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University