View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4474_high_1 (Length: 486)
Name: NF4474_high_1
Description: NF4474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4474_high_1 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 18 - 476
Target Start/End: Complemental strand, 43102655 - 43102197
Alignment:
| Q |
18 |
catggctcacacatatctaatattctctctccctgatctcatcacaaattcattcatccaccctatacgtatttaccttcgtgcacagggaatcactcgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102655 |
catggctcacacatatctaatattctctctccctgatctcatcacaaattcattcatccaccctatacgtatttaccttcgtgcacagggaatcactcgc |
43102556 |
T |
|
| Q |
118 |
ccagttacattagcctcacttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagttccagctgcctctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43102555 |
ccagttacattagcctcacttgctggcactctcctccatcttcctctaaattacttgtttgtctttcacttcggtttcaccggagtcccagctgcctctg |
43102456 |
T |
|
| Q |
218 |
cagcctccaacctcttcattgtgttgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagccaggagtgtctcac |
317 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43102455 |
cagcctccaacctcttcattgtattgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagtcaggagtgtctcac |
43102356 |
T |
|
| Q |
318 |
cggctggaagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttactt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102355 |
cggctggaagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttactt |
43102256 |
T |
|
| Q |
418 |
gtggaccccaccgtaaccattgcttctatcgggattctaattcaaactacttcattcat |
476 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102255 |
gtggaccccaccgttaccattgcttctatcgggattctaattcaaactacttcattcat |
43102197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 349 - 390
Target Start/End: Original strand, 24241 - 24282
Alignment:
| Q |
349 |
ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa |
390 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
24241 |
ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa |
24282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 358 - 410
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
| Q |
358 |
gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg |
410 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | ||||| ||||| ||||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg |
51875031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University