View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4474_low_12 (Length: 239)
Name: NF4474_low_12
Description: NF4474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4474_low_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 47202004 - 47201783
Alignment:
| Q |
18 |
ttatgttctgttttagtacatagtttcacttcacgctgaacgaacaccaaccacgtgattctgattctgacatttacccaagtacatgataaacaaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47202004 |
ttatgttctgttttagtacatagtttcacttcacgctgaacgaacaccaaccacgtgattctgattctgacatttacccaagtacatgataaacaaacaa |
47201905 |
T |
|
| Q |
118 |
gtacagtgtgtgtgttacactaaattcaacagtaccatattcttattattagtattataagaagaaacaaagtagccaacttttttcacttgtcgttcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201904 |
gtacagtgtgtgtgttacactaaattcaatagtaccatattcttattattagtattataagaagaaacaaagtagccaacttttttcacttgtcgttcat |
47201805 |
T |
|
| Q |
218 |
ggcttcaacaatgatgggtttt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47201804 |
ggcttcaacaatgatgggtttt |
47201783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University