View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4475-Insertion-10 (Length: 344)
Name: NF4475-Insertion-10
Description: NF4475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4475-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 344
Target Start/End: Original strand, 43478592 - 43478945
Alignment:
| Q |
8 |
gatacgtatacatatcaccgagaaagaaagnnnnnnngttacccagattcatgcctaggtgaaggtaagtgtaattatgttttgttactgtcgttgtatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||| |||||||||||| |||||||| |
|
|
| T |
43478592 |
gatacgtatacatatcaccgagaaagaagaaaaaaaagttacccagattcatgcctaggtgaaggcaagtgttgttattttttgttactgttgttgtatt |
43478691 |
T |
|
| Q |
108 |
gactcatatccaactcaagggtgtgacacggccaaggagtcactcgcgtcgcaaaaatgagcgatcacaaacatcaccttaacagcaattgattgca--- |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43478692 |
gactcatatccaactcaagggtgtgacacagccaaggagtcactcacgtcgcaaaaacgagcgatcacaaacatcaccttaacaacaattgattgcaaat |
43478791 |
T |
|
| Q |
205 |
--------------aacggaatgtaccattaaacgcatgaggcagctaccgaacaaagaaatttccattaaaatcaagtttcttttcattctgcaaacac |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43478792 |
aactgttgactgcaaacggaatgtaccattaaacgcatgaggcagctaccgaacaaagaaatttccattaaaatcaagtttcttttcattctgcaaacac |
43478891 |
T |
|
| Q |
291 |
tattcttaccaaattttttactagggtttcggagtcttcgcaaatccccaacga |
344 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43478892 |
tattcttaccaaaaaatttactagggttttggagtcttcgcaaatccccaacga |
43478945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University