View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4475_high_8 (Length: 250)
Name: NF4475_high_8
Description: NF4475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4475_high_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 44234681 - 44234936
Alignment:
| Q |
11 |
cacagaaaccgcatcaaaacacaccccaataattgaagttttcaaacctctttcacacacagatttctaataacccactttcatcaacaattttc----- |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44234681 |
cacagaaaccgcatcaaaacacaccccaataattgaagttttcaaacctctttcacacacagatttctaataacccactttcatcaacaattttcacggt |
44234780 |
T |
 |
| Q |
106 |
-----------tgtttctgaatttgcaaattctgtgaacaatttttgaaacctgagatgtgtgattcaaacatgcttttatatctacctgatgatgtatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44234781 |
tttttttttattgtttctgaatttgcaaattctgtgaacaatttttgaaacctgagatgtgtgattcaaacatgcttttatatctacctgatgatgtatt |
44234880 |
T |
 |
| Q |
195 |
tgcaataatttctaagtccttttcaccaagagatatatgcaatctgagtttatgct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44234881 |
tgcaataatttctaagtccttttcaccaagagatatatgcaatctgagtttatgct |
44234936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University