View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4475_high_9 (Length: 246)
Name: NF4475_high_9
Description: NF4475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4475_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 225
Target Start/End: Original strand, 37872411 - 37872621
Alignment:
| Q |
15 |
agcaaagggacatataatatactatgattgaatgcacgtgtgattttattttgggtgaaagtattaaattcgtatattgagtagttataaatagtgggtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37872411 |
agcaaagggacatataatatactatgattggatgcacgtgtgattttattttgggtgaaagtattaaattcgtatattgagtagatataaatagtgggtg |
37872510 |
T |
 |
| Q |
115 |
atccagatcgataaacttcaatgagagactctttataaatggtagatgagtttttccctcgtttaacactatttgacttgatgtgtagatacagatgacc |
214 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37872511 |
atccagattgataaacttcaacgagagactctttataaatggtagatgagtttttccctcgtttaacactatttgacttgatgtgtagatacaggtgacc |
37872610 |
T |
 |
| Q |
215 |
tagattgatag |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
37872611 |
tagattgatag |
37872621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University