View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4475_low_6 (Length: 300)
Name: NF4475_low_6
Description: NF4475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4475_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 153 - 290
Target Start/End: Complemental strand, 39718433 - 39718295
Alignment:
| Q |
153 |
ttctatgcaattcacatttaatttatttagcttggttcatgtatttttgnnnnnnnnnnnnnnn-ggagtcttcgttctttacccttttaagtcctgttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718433 |
ttctatgcaattcacatttaatttatttagcttggttcatgtatttttgaaaaaagaaaaaaaaaggagtcttcgttctttacccttttaagtcctgttt |
39718334 |
T |
 |
| Q |
252 |
cttattgccatgtgggtccctcccttgcactaccctatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39718333 |
cttattgccatgtgggtccctcccttgcactaccttatg |
39718295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University