View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4476-Insertion-8 (Length: 168)
Name: NF4476-Insertion-8
Description: NF4476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4476-Insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 122 - 165
Target Start/End: Original strand, 44730806 - 44730849
Alignment:
| Q |
122 |
acatcaacggacgatagttatagaaccacaacacctgtaactga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44730806 |
acatcaacggacgatagttatagaaccacaccacctgtaactga |
44730849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 44730771 - 44730810
Alignment:
| Q |
29 |
ttgtttccatcttgccatatacaatgaaggagccaacatc |
68 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
44730771 |
ttgtttccatcttgccatatacaatcaaggacccaacatc |
44730810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University