View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4476_low_16 (Length: 237)
Name: NF4476_low_16
Description: NF4476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4476_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 91 - 237
Target Start/End: Original strand, 24750019 - 24750165
Alignment:
| Q |
91 |
aatccacctttcattcctcccacattctcaaaatctctctttatccatcaaagttacaaaattttaaccaaaaaacccaacnnnnnnnntcaattaacta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24750019 |
aatccacctttcattcctcccacattctcaaaatctctctttatccatcaaagttacaaaattttaaccaaaaaacccaacaaaaaaaatcaattaacta |
24750118 |
T |
 |
| Q |
191 |
gttacaatgccaccaatatctggaaaactattcaccgttagtttgat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750119 |
gttacaatgccaccaatatctggaaaactattcaccgttagtttgat |
24750165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University