View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4477-Insertion-5 (Length: 211)
Name: NF4477-Insertion-5
Description: NF4477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4477-Insertion-5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 211
Target Start/End: Original strand, 21404348 - 21404552
Alignment:
| Q |
7 |
aacaatgtatgtaattatgtagagcatgcaaatatgaattcactagtttcttggacatgatcaaattaatcatacccttgagttgtttctttggttcagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21404348 |
aacaatgtatgtaattatgtagagcatgcaaatatgaattcactagtttcttggacatgatcaaattaatcatacccttgagttgtttctttggttcagc |
21404447 |
T |
|
| Q |
107 |
tgaggcaatagtagttgtaaccttgacacaagatcattaatctgtttctctttcaactttgaatctcttgagtttctttggctagacatgactctctttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21404448 |
tgaggcaatagtagttgtaaccttgacacaagatcattaatctgtttctctttcaactttgaatctcttgagtttctttggctagacatgactctctttt |
21404547 |
T |
|
| Q |
207 |
cttaa |
211 |
Q |
| |
|
||||| |
|
|
| T |
21404548 |
cttaa |
21404552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University