View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4477_low_6 (Length: 277)
Name: NF4477_low_6
Description: NF4477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4477_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 259
Target Start/End: Original strand, 27987877 - 27988122
Alignment:
| Q |
14 |
tagattcgaacacgggatctctgattaagttggaagaaaactctatcatctcattaaagtgatcttgggnnnnnnnacttctaatttggttgaaaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27987877 |
tagattcgaacacgggatctctgattaagttgaaagaaaactctatcatctcattaaagtgatcttgggtttttttacttctaatttggttgaaaacaat |
27987976 |
T |
|
| Q |
114 |
aaaaatttaatannnnnnnaaatgctaatgggtccccaccaggaaggggatgtggagagaatactctccgaggtgggaaatgtggatagggagcatttta |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27987977 |
aaaaatttaatatttttttaaatgctaatgggtccccaccaggaaggggatgtggagagaatactctccgaggtgggaaatgtggatagggagcatttta |
27988076 |
T |
|
| Q |
214 |
gatgacggtaattgggagtggggaagtactcccccgctatcgctct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27988077 |
gatgacggtaattgggagtggggaagtactcccccgctatcgctct |
27988122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 260
Target Start/End: Original strand, 27997774 - 27997898
Alignment:
| Q |
143 |
gggtccccaccaggaaggggatgtggagagaatactctcc-gaggtgggaaatgtggataggga------gcattttagatgacggtaattgggagtggg |
235 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| ||||| || |||||||| |||| |||||||||||||||| ||||||| ||| |
|
|
| T |
27997774 |
gggtccccacgaggaaggggatgtggagaaaatactcttttgaggttgggaatgtggacggggatgagaggcattttagatgacgggggttgggagcggg |
27997873 |
T |
|
| Q |
236 |
gaagtactcccccgctatcgctctg |
260 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
27997874 |
gaagtactccccttctatcgctctg |
27997898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 206
Target Start/End: Original strand, 27908425 - 27908471
Alignment:
| Q |
160 |
gggatgtggagagaatactctccgaggtgggaaatgtggatagggag |
206 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
27908425 |
gggatggggagagaatactctctgaggtggggaatgtggatggggag |
27908471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University