View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4477_low_8 (Length: 252)
Name: NF4477_low_8
Description: NF4477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4477_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 14212308 - 14212072
Alignment:
| Q |
1 |
tttatcgatctcgaaacggatagaaaaaatgagtattgatttaaattgccgtgtcgaggatttattaatcgaagaagcattgcagccactagaattctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14212308 |
tttatcgatctcgaaacggatagaaaaaatgagtattgatttaaattgccgtgtcgaggatttattaatcgaagaagcattgcagccactagaattccat |
14212209 |
T |
|
| Q |
101 |
ctctttgatcatgcaagcagaaatcatagactcggccnnnnnnnccgcgaagaaagttctaagatgaaattgcaaacattagaaaaatgtggtgaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212208 |
ctctttgatcatgcaagcagaaatcataaactcggcccgaaaaaccgcgaagaaagttctaagatgaaattgcaaacattagaaaaatgtggtgaagagt |
14212109 |
T |
|
| Q |
201 |
atattgtagacactgcatcgattttcgagagtttaat |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14212108 |
atattgtagacactgcatcgatttttgagagtttaat |
14212072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University