View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4477_low_9 (Length: 251)
Name: NF4477_low_9
Description: NF4477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4477_low_9 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 113 - 251
Target Start/End: Complemental strand, 14212484 - 14212346
Alignment:
| Q |
113 |
gaaacactttcaaattttttacagtataaaataagccacttttgtttctcttaaatattttagtggcagtatgggaaggttcacccaatggatcctcaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212484 |
gaaacactttcaaattttttacagtataaaataagccacttttgtttctcttaaatattttagtggcagtatgggaaggttcacccaatggatcctcaag |
14212385 |
T |
|
| Q |
213 |
atgtgatgcaagaacagctgaatgcaaaaaacataatta |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
14212384 |
atgtgatgcaagaacagctgagttcaaaaaacataatta |
14212346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 14212583 - 14212536
Alignment:
| Q |
14 |
tacttcagttcaacatgaacaaagattgaaaacttgcaatacagtaag |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212583 |
tacttcagttcaacatgaacaaagattgaaaacttgcaatacagtaag |
14212536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University