View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4478-insertion-7 (Length: 172)
Name: NF4478-insertion-7
Description: NF4478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4478-insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 7 - 172
Target Start/End: Complemental strand, 11024249 - 11024084
Alignment:
| Q |
7 |
atattgatccccgaatccgggcattgtaaccattggtactccggaacttattgcttccacggtcgcgttccagccacaatgcgttaagaatccgcctatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024249 |
atattgatccccgaatccgggcattgtaaccattggtactccggaacttattgcttccacggtcgcgttccagccacaatgcgttaagaatccgcctatc |
11024150 |
T |
|
| Q |
107 |
gatggatgatccaatattaacgcttgtggaacccatcctttaatcaacattcctttcttttcttcc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024149 |
gatggatgatccaatattaacgcttgtggaacccatcctttaatcaacattcctttcttttcttcc |
11024084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University