View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4478-insertion-8 (Length: 128)
Name: NF4478-insertion-8
Description: NF4478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4478-insertion-8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 28384552 - 28384432
Alignment:
| Q |
8 |
atttttagtagctcagttgttatctttcaggaaaaagctcacaaacatcggtatgggttaatagctcacgagaataaccaacatattgaatcagtggctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28384552 |
atttttagtagctcagttgttatctttcaggaaaaagctcacaaacatcggtataggttaatagctcacgagaataaccaacatattgaatcagtggctt |
28384453 |
T |
|
| Q |
108 |
tctgtaaatgagtgtgctgag |
128 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28384452 |
tctgtaaatgagtgtgctgag |
28384432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University