View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4478_high_10 (Length: 238)
Name: NF4478_high_10
Description: NF4478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4478_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 28384769 - 28384547
Alignment:
| Q |
1 |
aacattagtaaatatgttgaatcagtattatgcaaatgaatgtggtactactctttatctggtgtcaaggttcttggttctgtttcaggtttaactccaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28384769 |
aacattagtaactatgttgaatcagtattatgcaaatcaatgtggtactactctttatctggtgtcaaggttcttggttctgtttcaggtttaactccaa |
28384670 |
T |
|
| Q |
101 |
ttttaagtatcacaagtccttctatacggtctcaaacaatcccatatgcaataatattcaaagttggcatcaacctggatctctttaggataaaatcaat |
200 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28384669 |
ttttaagtatcataagtccttctatatggtctcaaacaatcccatatgcaataatattcaaagttggcatcaacctggatctctttaggataaaatcaat |
28384570 |
T |
|
| Q |
201 |
cctcaaatgatcacttcattttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28384569 |
cctcaaatgatcacttcattttt |
28384547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 42493446 - 42493497
Alignment:
| Q |
43 |
tggtactactctttatctggtgtcaaggttcttggttctgtttcaggtttaa |
94 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| || || |||||| |
|
|
| T |
42493446 |
tggtactgctctttatctggtgtcaacgttcttggttctattccatgtttaa |
42493497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University