View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4478_low_16 (Length: 227)
Name: NF4478_low_16
Description: NF4478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4478_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 37 - 215
Target Start/End: Complemental strand, 31881805 - 31881626
Alignment:
| Q |
37 |
gatacatattcacatttatcaccagtcacataagtcacttcttaattagaaacaacttgacaagtatacatgcagtgtt-----attaaacgtacagtta |
131 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
31881805 |
gatacatattcacatctatcaccagtcacataagtcacttctta----gaaacaacttcacaagtatacatgcagtgttgcattattaaacgtacaatta |
31881710 |
T |
 |
| Q |
132 |
ttgatcaccattatgtaattcatgctaccataattcacatatagaaacaacacaacgagtcaacacgaatagacacatatccac |
215 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31881709 |
ttgatcatcataatgtaattcatgctaccataattcacatatagaaacaacacaacgagtcaacacgaatagacacatatccac |
31881626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University