View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4479-Insertion-5 (Length: 314)
Name: NF4479-Insertion-5
Description: NF4479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4479-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 8 - 314
Target Start/End: Complemental strand, 39429219 - 39428912
Alignment:
| Q |
8 |
gtctttagcttgggccattgctcagctaggttggattgctggtcctgctgtcatgattttattctctttggttaccgtctctacttcttcctttcttgct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39429219 |
gtctttagcttgggccattgctcagctaggttggattgctggtcctgctgtcatgattttattctctttggttaccgtctctacttcttcctttcttgct |
39429120 |
T |
|
| Q |
108 |
gattgttatcgtgccggcgaccccgattccggcaagagaaactatacttacatggacgctgttcgatctattcttggtaaaactgcttctcctttattat |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
39429119 |
gattgttatcgtgccggcgacccccattccggcaagagaaactatacttacatggacgctgttcgctctattcttggtaacactgcttctcctttattat |
39429020 |
T |
|
| Q |
208 |
atttgacaaacagattatgttccttcgataacaaaaatattactaagtgtcaaaggtcttggagataacatggactgaaatatt-ttttgcaggtggagc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39429019 |
atttgacaaacagattatgttccttcgataacaaaaatattactaagtgtcaaaggtcttggagataacatggactgaaatatttttttgcaggtggagc |
39428920 |
T |
|
| Q |
307 |
taaggtta |
314 |
Q |
| |
|
|||||||| |
|
|
| T |
39428919 |
taaggtta |
39428912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 8 - 187
Target Start/End: Original strand, 6249389 - 6249553
Alignment:
| Q |
8 |
gtctttagcttgggccattgctcagctaggttggattgctggtcctgctgtcatgattttattctctttggttaccgtctctacttcttcctttcttgct |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | || ||||| |
|
|
| T |
6249389 |
gtctttagcttgggccatagctcagctaggttgggttgctggtcctgctgtcatgattttattctctttggttacagcctatactt-------------- |
6249474 |
T |
|
| Q |
108 |
gattgttatcgtgccggcgaccccgattccggcaagagaaactatacttacatggacgctgttcgatctattcttggtaa |
187 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6249475 |
-attgttatcgcaccggtgaccctgattccggcaagagaaaatatacttacatggacgctgttcgctccattcttggtaa |
6249553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 40207800 - 40207857
Alignment:
| Q |
8 |
gtctttagcttgggccattgctcagctaggttggattgctggtcctgctgtcatgatt |
65 |
Q |
| |
|
|||| |||||||||| |||||||| || || ||||||||||||||| |||||||||| |
|
|
| T |
40207800 |
gtctctagcttgggctattgctcaactcggatggattgctggtcctattgtcatgatt |
40207857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University