View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4479_high_4 (Length: 250)

Name: NF4479_high_4
Description: NF4479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4479_high_4
NF4479_high_4
[»] chr6 (2 HSPs)
chr6 (68-137)||(1402015-1402084)
chr6 (201-244)||(1402148-1402191)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 68 - 137
Target Start/End: Original strand, 1402015 - 1402084
Alignment:
68 ggcgactttactagcgtcagggggtgctggacatatttatcctaaaactacgaatccgttggtagttctc 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1402015 ggcgactttactagcgtcagggggtgctggacatatttatcctaaaactacgaatccgttggtagttctc 1402084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 244
Target Start/End: Original strand, 1402148 - 1402191
Alignment:
201 aggtatttaataacacgaatcatgatgaaaaatagaataatcta 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
1402148 aggtatttaataacacgaatcatgatgaaaaatagaataatcta 1402191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University