View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4480_high_4 (Length: 315)
Name: NF4480_high_4
Description: NF4480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4480_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 230 - 287
Target Start/End: Complemental strand, 49807265 - 49807208
Alignment:
| Q |
230 |
ggaaccattacccataacagcgccactctcttcttcttcaccagaaaacaccattgat |
287 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49807265 |
ggaaccattacccataacagcaccactctcttcttcttcaccagaaaacaccattgat |
49807208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 98 - 129
Target Start/End: Complemental strand, 49808121 - 49808090
Alignment:
| Q |
98 |
aagttgccattctcattgtttcttctacctct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49808121 |
aagttgccattctcattgtttcttctacctct |
49808090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 34045792 - 34045738
Alignment:
| Q |
230 |
ggaaccattacccataacagcgccactctcttcttcttcaccagaaaacaccatt |
284 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
34045792 |
ggaaccattacccataagagcaacaacctcttcttcttcaccagaaaacaccatt |
34045738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University