View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4480_low_2 (Length: 387)
Name: NF4480_low_2
Description: NF4480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4480_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 10554002 - 10554360
Alignment:
| Q |
1 |
aaaagtgaatgaataagggttagcttgagatttctatatataggagataagagaaagagatgattagggttctcttctttatggatctttgactcggggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554002 |
aaaagtgaatgaataagggttagcttgagatttctatatataggagataaga------gatgattagggttctcttctttatggatctttgactcggggg |
10554095 |
T |
 |
| Q |
101 |
ttactcccatgtcgctactattgatgtgctttaatgtctttataaatattctctatcgtgatgtgatccttgttagtctacaaggatgttgggtgtagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554096 |
ttactcccatgtcgctactattgatgtgctttaatgtctttatatatattctctatcgtgatgtgatccttgttagtctacaaggatgttgggtgtagtc |
10554195 |
T |
 |
| Q |
201 |
tcttgccatggct-----gtatgaatgtggagctggttcatcttgtatacctgaggagcaaatatcggtttggatatggggtttccataactgagatact |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554196 |
tcttgccatggctctagagtatgaatgtggagctggatcatcttgtatacctgaggaggaaatatcggtttggatatggggtttccataactgagatact |
10554295 |
T |
 |
| Q |
296 |
nnnnnnntcaacatgttgagctgcaatccttgaagcacaccaatggaaactagctcaaatccgagaaat |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10554296 |
aaaaaaatcaacatgttgagctgcaatccttgaagca----aatggaaactagctcaaatccgagaaat |
10554360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University