View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4481-Insertion-12 (Length: 160)

Name: NF4481-Insertion-12
Description: NF4481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4481-Insertion-12
NF4481-Insertion-12
[»] chr3 (9 HSPs)
chr3 (8-153)||(34468534-34468679)
chr3 (8-94)||(27629709-27629795)
chr3 (87-152)||(34469006-34469071)
chr3 (8-141)||(34522410-34522542)
chr3 (10-94)||(34488205-34488289)
chr3 (46-144)||(34509693-34509791)
chr3 (41-143)||(34488445-34488547)
chr3 (41-144)||(27629952-27630055)
chr3 (41-143)||(34522652-34522754)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 153
Target Start/End: Original strand, 34468534 - 34468679
Alignment:
8 tgttcaacttcagacacctcttgtggctgggaaatgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgagt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34468534 tgttcaacttcagacacctcttgtggctgggaaatgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgagt 34468633  T
108 tgaggtagcttgatacagctctggtgttggttacctctccgggccg 153  Q
    |||||||||||| |||||||||||||||||||||||||| ||||||    
34468634 tgaggtagcttggtacagctctggtgttggttacctctctgggccg 34468679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 27629709 - 27629795
Alignment:
8 tgttcaacttcagacacctcttgtggctggg-aaatgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagg 94  Q
    ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||| ||| ||| |||||    
27629709 tgttcaacttcagacacctctggtggctgggaaaatgaacttgcctcagattggggag-aggtggaggagacacgaaaacttcatagg 27629795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 87 - 152
Target Start/End: Complemental strand, 34469071 - 34469006
Alignment:
87 ttgatagggtgctgattgagttgaggtagcttgatacagctctggtgttggttacctctccgggcc 152  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||    
34469071 ttgatagggtgctgattgagttgaggtagcttggtacagctctggggttggttacctctctgggcc 34469006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 141
Target Start/End: Original strand, 34522410 - 34522542
Alignment:
8 tgttcaacttcagacacctcttgtggctgggaaa-tgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgag 106  Q
    ||||||||||||||||||||| || | ||||||| ||||||||||||||||||||||| ||||| ||||||||| ||| ||||||||| ||  ||| ||     
34522410 tgttcaacttcagacacctctggtagttgggaaaatgaacttgcctcagattggggag-aggtgaaggagacacgaaaacttgataggatgtagatggaa 34522508  T
107 ttgaggtagcttgatacagctctggtgttggttac 141  Q
     |||||| ||||||| |||||| |||| |||||||    
34522509 ctgaggttgcttgatgcagctc-ggtgctggttac 34522542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 6e-20
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 34488205 - 34488289
Alignment:
10 ttcaacttcagacacctcttgtggctgggaaa-tgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagg 94  Q
    ||||||||||| ||||||| |||||||| ||| ||||||||||||||||||||||| ||||||||||||||| ||| |||||||||    
34488205 ttcaacttcagtcacctctggtggctggtaaaatgaacttgcctcagattggggag-aggtggaggagacacgaaaacttgatagg 34488289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 46 - 144
Target Start/End: Original strand, 34509693 - 34509791
Alignment:
46 cttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgagttgaggtagcttgatacagctctggtgttggttacctc 144  Q
    ||||||| ||||||| ||| ||||||||||||||||||| |||||| |||||  ||| ||  |||||||||||| | |||||| | || ||||||||||    
34509693 cttgcctaagattggagagaaggtggaggagacaccaaaacttgatcgggtgtagatggaactgaggtagcttggtgcagctcggatgctggttacctc 34509791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 41 - 143
Target Start/End: Complemental strand, 34488547 - 34488445
Alignment:
41 atgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgagttgaggtagcttgatacagctctggtgttggtta 140  Q
    ||||||||| ||| || |||||||||||| |||||||||| ||| || | |||||||| ||| || ||  ||| ||||||| |||||| |||| ||||||    
34488547 atgaacttgtctcggaatggggagcaggtagaggagacacaaaaactggttagggtgcagatggaattttggttgcttgatgcagctcaggtggtggtta 34488448  T
141 cct 143  Q
    |||    
34488447 cct 34488445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 41 - 144
Target Start/End: Complemental strand, 27630055 - 27629952
Alignment:
41 atgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgagttgaggtagcttgatacagctctggtgttggtta 140  Q
    ||||||||| ||| |||||| ||||||||||||||||||| ||| || | |||||||| ||| ||  | |||| ||||||| |||||   ||| ||||||    
27630055 atgaacttgtctcggattggagagcaggtggaggagacacgaaaactggttagggtgcagatggaacttaggttgcttgatgcagctaaagtggtggtta 27629956  T
141 cctc 144  Q
    ||||    
27629955 cctc 27629952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 41 - 143
Target Start/End: Complemental strand, 34522754 - 34522652
Alignment:
41 atgaacttgcctcagattggggagcaggtggaggagacaccaaatcttgatagggtgctgattgagttgaggtagcttgatacagctctggtgttggtta 140  Q
    ||||||||| ||| || ||||||||||||||||||||||| ||| || | ||||| || |||  |  | |||| ||||||| |||||| |||| ||||||    
34522754 atgaacttgtctcggaatggggagcaggtggaggagacacgaaaactggttagggggcagatgaaacttaggttgcttgatgcagctcaggtggtggtta 34522655  T
141 cct 143  Q
    |||    
34522654 cct 34522652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University