View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4481_high_22 (Length: 215)
Name: NF4481_high_22
Description: NF4481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4481_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 32724144 - 32723954
Alignment:
| Q |
1 |
catttaaatatttccatccataccttatgcacaaaatcacaaagacaatgacatatgttttcatgattctttatatctaaagtacattgcataatttaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724144 |
catttaaatatttccatccataccttatgcacaaaatcgcaaagacaacgacatatgtttgcatgattctttatatctaaagtacattgcataatttaag |
32724045 |
T |
|
| Q |
101 |
tcatgatcaactcgaataacaccatgtttagctagctcatcacgagtcgacaatctccctagcaatgatctcctccacccaaataactgaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724044 |
tcatgatcaactcgaataacaccatgtttagctagctcatcacgagtcgacaatctccctagcaatgatctcctccacccaaataactgaa |
32723954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University