View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4481_high_7 (Length: 460)

Name: NF4481_high_7
Description: NF4481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4481_high_7
NF4481_high_7
[»] chr7 (3 HSPs)
chr7 (214-441)||(7969180-7969407)
chr7 (263-441)||(37577697-37577873)
chr7 (330-399)||(32895222-32895287)
[»] chr5 (5 HSPs)
chr5 (278-407)||(32651175-32651301)
chr5 (263-370)||(25470010-25470117)
chr5 (330-433)||(32740594-32740694)
chr5 (263-358)||(32768567-32768662)
chr5 (264-342)||(28475450-28475529)
[»] chr4 (1 HSPs)
chr4 (263-314)||(2166106-2166159)


Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-113; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 214 - 441
Target Start/End: Original strand, 7969180 - 7969407
Alignment:
214 tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacaataatgtattatttctctacttatagggagattgtcttcatgacaaggg 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
7969180 tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacagtaatgtattatttctctacttatagggagattgtcttcatgacaaggg 7969279  T
314 ttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggc 413  Q
    |||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
7969280 ttgccgacagtggcagatgatgaggtggatgattgcctgcttttggatttagtaattggtgatgatggcgcagtggtcatctagtctccgatgaggcggc 7969379  T
414 tgacgaggtggagggttgacctctcttg 441  Q
    ||||||||||||||||||||||||||||    
7969380 tgacgaggtggagggttgacctctcttg 7969407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 263 - 441
Target Start/End: Complemental strand, 37577873 - 37577697
Alignment:
263 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 362  Q
    ||||||||||| | ||||| ||||||| || |||||||||||||||||||||  || || ||||||||  |||||||||| | |||| |||||||||||     
37577873 caataatgtatgacttctcaacttatatggtgattgtcttcatgacaagggtcaccaacggcggcagacaatgaggtggacggttgcatgctcttggatg 37577774  T
363 tagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggttgacctctcttg 441  Q
    || ||||||| |  ||| |||| | ||||||||| || || |||| ||||  |||||  | |||||||||| |||||||    
37577773 tattaatcgggg--gattgtgcggaggtcatctaatcccccatgatgcggaggacgaatttgagggttgacttctcttg 37577697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 399
Target Start/End: Complemental strand, 32895287 - 32895222
Alignment:
330 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtc 399  Q
    ||||| ||||||||| |||||||||||||||| ||||||| ||||||||    |||||||||||||||||    
32895287 atgataaggtggatggttgcctgctcttggatgtagtaat-ggtgatga---cgcagtggtcatctagtc 32895222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 5e-23; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 278 - 407
Target Start/End: Original strand, 32651175 - 32651301
Alignment:
278 tctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatg 377  Q
    ||||||||||||||| || ||||||| ||| || |||||||||  || ||||||||||||||||| | ||| || ||||||||| ||||||||||    |    
32651175 tctctacttatagggtgactgtcttcgtgataacggttgccgatggcagcagatgatgaggtggacggttgacttctcttggatatagtaatcgg---cg 32651271  T
378 atggtgcagtggtcatctagtctccgatga 407  Q
    |||||||||||||||||||||| |||||||    
32651272 atggtgcagtggtcatctagtccccgatga 32651301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 263 - 370
Target Start/End: Complemental strand, 25470117 - 25470010
Alignment:
263 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 362  Q
    ||||||| ||||| || ||||||||||||| |||||||||||||| |  ||| |||||  || || ||||||||||| |||| ||||||||||||||||     
25470117 caataatatattaattttctacttatagggtgattgtcttcatgatacaggtcgccgatggcagcggatgatgaggttgatggttgcctgctcttggatg 25470018  T
363 tagtaatc 370  Q
    ||||||||    
25470017 tagtaatc 25470010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 330 - 433
Target Start/End: Complemental strand, 32740694 - 32740594
Alignment:
330 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggt 429  Q
    ||||| |||||||  ||||||  ||||||||| ||||||||||||||| || ||   |||||||||||||||| | |||||||  |||||||||||||||    
32740694 atgataaggtggacaattgccaactcttggatgtagtaatcggtgatggtgttg---tggtcatctagtctccaaggaggcggaggacgaggtggagggt 32740598  T
430 tgac 433  Q
    ||||    
32740597 tgac 32740594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 263 - 358
Target Start/End: Complemental strand, 32768662 - 32768567
Alignment:
263 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttg 358  Q
    ||||||||||||| ||  |||||||||||| | |||||||||||| ||||||  ||||| |||||| | ||||||||||| |  ||||||||||||    
32768662 caataatgtattactttactacttatagggtgtttgtcttcatgataagggtccccgacggcggcaaacgatgaggtggacggctgcctgctcttg 32768567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 342
Target Start/End: Complemental strand, 28475529 - 28475450
Alignment:
264 aataatgtattatttctctacttatagggag-attgtcttcatgacaagggttgccgacagcggcagatgatgaggtgga 342  Q
    ||||||| || | |||||||| ||||||| | |||||||||| || ||||||||||||||||||  || |||||||||||    
28475529 aataatgcatgacttctctacatatagggtggattgtcttcacgataagggttgccgacagcggtggacgatgaggtgga 28475450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 263 - 314
Target Start/End: Original strand, 2166106 - 2166159
Alignment:
263 caataatgtat--tatttctctacttatagggagattgtcttcatgacaagggt 314  Q
    |||||||||||  ||| |||||| ||||| ||||||||||||||||||||||||    
2166106 caataatgtatgatatctctctagttataaggagattgtcttcatgacaagggt 2166159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University