View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4481_low_20 (Length: 296)
Name: NF4481_low_20
Description: NF4481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4481_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 140 - 286
Target Start/End: Complemental strand, 21971277 - 21971128
Alignment:
| Q |
140 |
gtgatagtcaactcctatgcaaaaagtcaactctattcatttttgaactttgaataagatagcaacattactacacataaagttcaaagcaactttgatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21971277 |
gtgatagtcaactcctatgcaaaaagtcaactctattcatttttgaactttgaataagatagcaacattactacacataaagttcaaaacaactttgatt |
21971178 |
T |
 |
| Q |
240 |
gc---attgcactatccaatgggtaacaaaatcagcaatttgtgcctttg |
286 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21971177 |
gcattattgcactatccaatgggtaacaaaatcagcaatttgtgcctttg |
21971128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 21971399 - 21971349
Alignment:
| Q |
18 |
tatttctatttttgatattaagagtacacgtgattcttcttcccccttaag |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21971399 |
tatttctatttttgatattaagagtacacgtgattcttcttcccccttaag |
21971349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University