View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4481_low_24 (Length: 232)
Name: NF4481_low_24
Description: NF4481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4481_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 36126165 - 36125949
Alignment:
| Q |
5 |
tcaacatctcaccttcttcgcctctactcccaccacctatgcttttatccaacacttctccactccacccttccctcactatagattccacccacattgc |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36126165 |
tcaacatctcaccttcttcacctctactcccaccacctatgcttttatccaacacttctccactccacccatccctcactatagattccacccacattgc |
36126066 |
T |
|
| Q |
105 |
taaatcttcatttgctcccttcccatgcctcaaataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgctc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126065 |
taaatcttcatttgctcccttcccatgcctcaaataatttgcagggaacttccctgtcaatagctccaatataagtatccctaaacaccatacgtcgctc |
36125966 |
T |
|
| Q |
205 |
ttctcgctcggcccttc |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36125965 |
ttctcgctcggcccttc |
36125949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University