View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4483-Insertion-5 (Length: 181)
Name: NF4483-Insertion-5
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4483-Insertion-5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 9 - 181
Target Start/End: Complemental strand, 14522421 - 14522249
Alignment:
| Q |
9 |
atgatgctctcaacatacaacaaatgcattgtttctttgacgttgttgtgtttctgtttagggttttcacaaggtggtatcaaacaaggtgatgttgtaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
14522421 |
atgatgctctcaacatacaacaaatgcattgtttcttttacgttgttgtgtttctgtttagggttctcacaaggtggtatcaaacaaggtgatattgtaa |
14522322 |
T |
|
| Q |
109 |
gagatcaagaaggtgatgttttattctcagatggtttcaactttgccatgggtttctttggtttcggcaactc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14522321 |
gagatcaagaaggtgatgttttattctcagatggtttcaactttgctatgggtttctttggtttcggcaactc |
14522249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 172
Target Start/End: Complemental strand, 2693267 - 2693181
Alignment:
| Q |
86 |
tatcaaacaaggtgatgttgtaagagatcaagaaggtgatgttttattctcagatggtttcaactttgccatgggtttctttggttt |
172 |
Q |
| |
|
||||||||||||||| || | ||||| |||| ||||| ||||||||||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
2693267 |
tatcaaacaaggtgactttatcagagacgaagatggtgaagttttattctcagatgggcacaacttcgtaatgggtttctttggttt |
2693181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University