View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4483-Insertion-6 (Length: 148)
Name: NF4483-Insertion-6
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4483-Insertion-6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 39711725 - 39711601
Alignment:
| Q |
8 |
acataaccactcaacctcgtagaatccgactgattaggaggtggtgcaggagaatcattattggtagaaggtggaggagtttcgctttgagcacttggtg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39711725 |
acataaccactcaacctcgtagaatccgactgattaggaggtggtgcaggagaatcattattggtagaaggtggaggagtttcgctttgagcacttggtg |
39711626 |
T |
|
| Q |
108 |
gtgaatcagtcttttcggtagcact |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39711625 |
gtgaatcagtcttttcggtagcact |
39711601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University