View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4483_high_14 (Length: 229)

Name: NF4483_high_14
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4483_high_14
NF4483_high_14
[»] chr3 (1 HSPs)
chr3 (5-134)||(39385938-39386067)


Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 5 - 134
Target Start/End: Original strand, 39385938 - 39386067
Alignment:
5 atgaatgggagagtatggttaactttttgttgatggaatagtatgcttaatttttgctcttaccattccagtagtcaccgcatgccacaacttccatcta 104  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39385938 atgaatgggagagtatggtttactttttgttgatggaatagtatgcttaatttttgctcttaccattccagtagtcaccgcatgccacaacttccatcta 39386037  T
105 tgcaaaagcacaaattaaggagtgagaaca 134  Q
    ||||||||||||||||||||||||||||||    
39386038 tgcaaaagcacaaattaaggagtgagaaca 39386067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University