View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4483_high_14 (Length: 229)
Name: NF4483_high_14
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4483_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 5 - 134
Target Start/End: Original strand, 39385938 - 39386067
Alignment:
| Q |
5 |
atgaatgggagagtatggttaactttttgttgatggaatagtatgcttaatttttgctcttaccattccagtagtcaccgcatgccacaacttccatcta |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385938 |
atgaatgggagagtatggtttactttttgttgatggaatagtatgcttaatttttgctcttaccattccagtagtcaccgcatgccacaacttccatcta |
39386037 |
T |
 |
| Q |
105 |
tgcaaaagcacaaattaaggagtgagaaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39386038 |
tgcaaaagcacaaattaaggagtgagaaca |
39386067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University