View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4483_low_11 (Length: 273)
Name: NF4483_low_11
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4483_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 38186418 - 38186657
Alignment:
| Q |
13 |
aaaatgccccttacaaaaatgatggaaagtgaaagaaaggaaaccaaaaacaatttcttctcttctttggttgattgaaaataggaggagagaataaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38186418 |
aaaatgccccttacaaaaatgatggaaagtgaaagaaaggaaaccaaaaacaatttcttctctt---tggttgattgaaaataggaggagagaataaact |
38186514 |
T |
|
| Q |
113 |
atacacaaaacccctgtgagttttgtggtgaatatttgaaattgaaaaatatgtttctttataggttttgggttcaaactctcagatgtcaatgatttac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38186515 |
atacacaaaacccctgtgagttttgtggtgaatatttgaaatcaaaaaatatgtttttttataggttttgggtttaaattctcagatgtcaatgatttac |
38186614 |
T |
|
| Q |
213 |
gtgtatgatcaattcttacatgactttgttttgacttcaatta |
255 |
Q |
| |
|
||||||||||||||| || || |||||| |||||||||||||| |
|
|
| T |
38186615 |
gtgtatgatcaattcatagataactttgctttgacttcaatta |
38186657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University